jeffnlv jeffnlv

03-04-2018
Health

contestada

What are more accurate than pedometers at tracking distance

Respuesta :

gavinkmullen gavinkmullen

03-04-2018

GPS fitness monitors I hope those helps

Answer Link

03-05-2022

It's option D, GPS fitness monitors

Answer Link

Otras preguntas

Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these

A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou

How did the triple alliance and the triple entente change during the war?

Which correctly describes the reaction between potassium and excess water?

Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

How did southern slaveholders claim that the North benefited from slavery? 1. They demonstrated that slavery was the foundation of the entire American economy.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

this has me so confused on how you get the answers

What’s the answer to #12? and why