khanikhani khanikhani
  • 01-12-2017
  • Biology
contestada

researcher uses scientific studies to draw conclusions. Which of the following would we call this?

Respuesta :

bmisses
bmisses bmisses
  • 01-12-2017
We would call this scientific research
Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Acording to the constitution how long is a senators term?
who is john jacob jinglehighmershmdit???
x-21<31 Solve the inequality and enter your solution as an inequality comparing the variable to a number
What is the partial pressure of carbon dioxide in a container that contains 3.63 mol of oxygen, 1.49 mol of nitrogen, and 4.49 mol of carbon dioxide when the to
An angle measures 92° more than the measure of its supplementary angle. What is the measure of each angle?
If (2x − 4)(3x + 2) = 0, what are all possible values of x ? Select one: A. 0 only B. −23 only C. 0 and 2 only D. −23 and 2 only
- Match the base pairs: 5’-AGGTCCG- 3’=
Match the sentences with the correct form of the verb 'ir' according to 'who' is going. Mi madre ______ al trabajo. Yo ________ a la casa de mi abuela. Mi primo
List 3 synonyms and antonyms for the word Burlap.