MIALLSSS MIALLSSS
  • 02-02-2024
  • Mathematics
contestada

.
Question
If C = 2 + 4x and D = 2x - 2, find an expression that equals 3C + D in standard form.

Respuesta :

yougotcancer453 yougotcancer453
  • 02-02-2024

Answer: 14x+4

Step-by-step explanation:

3(2+4x)+2x-2

simplify

Distribute: 6+12x+2x-2

Add like terms: 14x+4

Answer Link
jimrgrant1 jimrgrant1
  • 02-02-2024

Answer:

3C + D = 14x + 4

Step-by-step explanation:

given

C = 2 + 4x and D = 2x - 2

Then

3C + D

= 3(2 + 4x) + 2x - 2 ← distribute parenthesis by 3

= 6 + 12x + 2x - 2 ← collect like terms

= (12x + 2x) + (6 - 2)

= 14x + 4

Answer Link

Otras preguntas

With the two endpoints of a diamter how many right triangles can be formed
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?
These tools were crucial in scientists' and physicians' ability to work together and collaborate to solve problems and learn about disease. A) the Internet and
What name was given to the fight over slavery in the Kansas territory in the mid-1800’s?
If XY=18, YZ=14, and XZ=20, find the radius of each circle.
In which sentence does the underlined noun clause function as the object of a preposition. Our group sends whoever requests information a newsletter and a link
Really need some helpUse the diagram below. Write AD/AB in simplest form.
Solve for x in terms of the other matrices and/or their inverses. x=b+ax
I need help with this problem!