faranaaa1
faranaaa1 faranaaa1
  • 03-03-2017
  • Biology
contestada

Which state is most likely to produce sargassum?

Respuesta :

kaitlynj348
kaitlynj348 kaitlynj348
  • 03-03-2017
Florida is most likely to produce sargassum
Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
x-16<24 Solve the inequality and enter your solution as an inequality comparing the variable to a number
Two engineers submitted sealed bids to a prospective client for a design project. The client told Engineer A how much Engineer B had bid and invited Engineer A
Multiply simplified answer and give as a mixed number 6 3/5 multiply by 2 1/4
A 2-m3 rigid tank initially contains air at 100 kPa and 22oC. The tank is connected to a supply line through a valve. Air is flowing in the supply line at 600 k
List several economic indicators. What is the purpose of measuring economic indicators? What do they measure?
What effect did the case have on the Republican Party
An angle measures 42° more than the measure of its complementary angle. What is the measure of each angle?
Which catalyzed reaction breaks up ozone? 2H2O2(l) right arrow with upper M n upper O subscript 2 above it. 2H2O(l) + O2 O3 + O Right arrow with upper C upper S
On a very hot summer day, 5 percent of the production employees at Highlander Steel are dehydrated. The production employees are randomly selected for a special