sophial sophial
  • 01-02-2015
  • Physics
contestada

which liquid will evaporate the fastest water salt water pepsi and gatorade?

Respuesta :

0Claudia0
0Claudia0 0Claudia0
  • 01-02-2015
The liquid that will evaporate the quickest would be water. 
~The rest are mixtures, and have more ingrediants in them, therefore the answer should be water. (in which it has no other ingrediants in it but water itself)
Answer Link

Otras preguntas

What would be the most likely effect of one company buying a competitor?
how do you know 8 thousandths is less than 1 hundredths
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
is a centimeter one tenth or one hundredth or a meter
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a