jimmiefking jimmiefking
  • 02-12-2021
  • Arts
contestada

please list the three steps the Egyptians used when painting.

Respuesta :

2355711577
2355711577 2355711577
  • 02-12-2021

Answer:

In Egypt this was often made from the mineral gypsum mixed with glue. The artist then paints a background color followed by an outline in red or black. The colors are then filled in one by one; here red was painted first, then green, then blue. Sometimes a layer of varnish or other coating is added on top.

Explanation:

Answer Link

Otras preguntas

find the greatest common divisor of 9 and 27
We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church
What is one popular pop artist or group (from today or from the past)?
NEED HELP PLEASE WORTH 15 POINTS Which equation would best help solve the following problem? The height of a triangle is 4 m less than its base. The area of the
Who basically "began" England's religious reformation?
I need help on exterior angles!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Percy Bysshe Shelley's poem "Ode to the West Wind" is significant because it A. explores the human need for love and companionship. B. uses satire to make fun
One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61