Gresika9 Gresika9

01-07-2021
English

contestada

what are the uses of the definite article "the".Give two examples of each

Respuesta :

felixchenmain felixchenmain

01-07-2021

Answer:

The cat sat on the mat.

The dog barked.

Explanation:

The word the is being used to define an article, to show its existence

Answer Link

Otras preguntas

What’s the missing side?

NEED HELP FAST!!! The difference of the values of the third quartile and the median of the data set represented by the box plot is (Pictured Below)

Find the absolute maximum and minimum values of the function f(x, y) = x2 + xy + y2 on the disc x2 + y2 ≤ 1. (you do not have to use calculus.)

The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

can someone help me please

World war 2 officially began with hostilities between what two nations A. Japan and the United States B. Germany and Poland C. Japan and China D. Germany an

With respect to their direct effects on osseous tissue, which pair of hormones has actions that oppose each other?

What is the value of x?

Which of the following props should you suggest to clients with tight muscles and physical restrictions? A. Pillow and an exercise block B. Exer