03-06-2021
Mathematics

contestada

The area of the triangle is 0.2 square feet. What is the triangle's height, h?

Respuesta :

AlexTrusk AlexTrusk

03-06-2021

Answer:

we need to know it's width. the questions has not enough information

Answer Link

Otras preguntas

Write a do-while loop that continues to prompt a user to enter a number less than 100, until the entered number is actually less than 100. End each prompt with

Which object has a mass of about 1 kg

During the recovery of a cold-worked material, which of the following statement(s) is (are) true? O Some of the internal strain energy is relieved. O All of t

N the sentence "We not only preserve important historic sites within national park boundaries, but also work beyond those boundaries to ensure that everyone's h

The supreme executive power shall be vested in a governor, who shall be cammander-in-chief of all military forces of the state not in active service of the Unit

Parallel, intersecting or skew? AB and BC. AE and BF. EF and AD. Plane ABC and Plane ABF. Plane AED and Plane BFC. HELP!!!

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

A regular pentagon is divided into congruent triangles by drawing a line segment from each vertex to the center. Each triangle has an area of 24. What is the ar

why would establishing an agricultural college be a way to enhance a country's rate of development?

3. A balancing balloon toy is in the shape of a hemisphere (half-sphere) attached to the base of a cone. If the toy is 4ft tall and 2ft wide, what is the volume