dewayne123 dewayne123
  • 02-06-2021
  • French
contestada

How does Jake plan on distracting the guard’s attention?

Pushing a kitchen cart down the corridor.
Shining his flashlight on a wall.
Tapping on the wall.
Throwing a coin in his direction.

Respuesta :

aaayyyaaa aaayyyaaa
  • 02-06-2021
either the first or the last (1 or 4)
Answer Link

Otras preguntas

what is the percent change from 70 to 56?
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
what rule does static electricity follow
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
testosterone directly affects the
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Explain who or what "Año Viejo" is and its significance.
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?