andreapahola andreapahola
  • 04-05-2021
  • English
contestada

What do yo wish you knew at the very beginning of this pandemic and what would you tell yourself about what was to come?

Respuesta :

andrea02163 andrea02163
  • 04-05-2021

Answer:

that its overrrated

Explanation:

Answer Link

Otras preguntas

Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Why was wilson not able to finish his speaking tour
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
In which system of government would states function independently of each other?
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5