pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

What is the representative particle of Fe?
which is bigger 5/8 or 7/12
What is the principle called of the conservation of matter?
What factors would affect the length of a day?How would the length of the day affect the temperature?
how do i solve 7x-y=21
Write each rational numbe as a fraction
what is the greatest common factors of 12 and 27
Shawna has 3 adults 2 children coming over for dessert. she going to serve 2 small apple pies. if she plans to give each person, including herself,an equal amou
What are the 4 types of processes that cycle matter through the biosphere give examples?
What effect did the formation of the Society of Jesus have on the Roman Catholic Church?