shnikamartin shnikamartin
  • 04-02-2021
  • Mathematics
contestada

Simplify 4(7-10)^/(-6)-5*(-2)

Respuesta :

allenizuleta14
allenizuleta14 allenizuleta14
  • 04-02-2021
Use your calculator put all of them together then you’ll get your answer
Answer Link

Otras preguntas

What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how to i do 7/16÷(31/2÷1/2)
What was religion like in Shang China?
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
i need help with #3
What is the range of function of y-1=(x+3)^2