ilovetosing
ilovetosing ilovetosing
  • 02-02-2021
  • English
contestada

good and bad things about a crush

Respuesta :

cardwelltrinc
cardwelltrinc cardwelltrinc
  • 02-02-2021

Answer:

Pros:    

You have someone to love

You have someone to devote your time to

Cons:

You worry if they like you or not XDD

Answer Link
Аноним Аноним
  • 02-02-2021

Good:

They might like you back

Its good to talk about them

Its secretive

Nice to like someone

Bad:

They might not like you back

They might find out

They might tell everyone

Answer Link

Otras preguntas

plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.
What did Chinese traders exchange with Islamic merchants?
the push or pull that exists between interacting objects is
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession
Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.
Please help!!!! URGENT!!!!!!!!!!!!!!!!!!!!!
(60) Points HeLp asap 5 questions
x to the 2 power plus 4x plus 3[tex]x{2} + 4x + 3 = [/tex]
List and briefly describe each of the five strength training principles. (Site 1)