rallen121011 rallen121011

01-05-2020
Physics

contestada

The temperature of an object is a measure of the average thermal energy of the molecule in the object true or false

Respuesta :

msconaway54 msconaway54

13-05-2020

Answer:false

Explanation:

Answer Link

Otras preguntas

An employee working in a machine shop is exposed to three different sources which emit noises at 81 dB, 91 dB, and 88 dB. What is the combined noise level expos

What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

In a standard normal curve, what percentile corresponds to a z-score of 2.0?

Alice spent 6 minutes on each factoring problem and 3 minutes on each evaluation problem. she spent a total of 42 minutes on 9 problems. how many minutes did sh

Write the polynomial in standard form. then name the polynomial based on its degree and number of terms.2 – 11x2 – 8x + 6x2

(hc) "in the government of this commonwealth, the legislative department shall never exercise the executive and judicial powers, or either of them. the executiv

During the song dynasty, the chinese economy expanded because question 19 options: new fishing methods created a surplus of food. song warriors destroyed the mo

Personal care quiz---when providing nail care it is important to consult a professional true or false

What is the difference between a settler an an explorer social studies?