dancingkaedinbug dancingkaedinbug

03-04-2020
Mathematics

contestada

write an equation of the line that is parallel to 5x+20y=10 and passes through the point (8,3).

Respuesta :

meredith48034 meredith48034

05-04-2020

Answer:

20y = -5x + 10

y = -1/4x + 1/2

y - 3 = -1/4(x - 8)

y - 3 = -1/4x + 2

y = -1/4x + 5

Step-by-step explanation:

Answer Link

Otras preguntas

Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens

3m2+7=55 answer please

what is the value of the expression i × i²× i³× i⁴

can anyone help me to solve these 2 questions please I need very clear steps !!!!

the expression 3.25b + 2h gives the cost of b burgers and h hot dogs what is the cost of 4 burgers and 6 hot dogs

What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis

What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid

Your religious identity is only important for you within your family and does not matter in the public sphere.

From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat