ddhsjhs2090 ddhsjhs2090
  • 01-04-2020
  • Physics
contestada

How high a liquid will rise up a narrow tube as a result of capillary action depends on ________.

Respuesta :

wagonbelleville wagonbelleville
  • 04-04-2020

Answer

Capillary action is the tendency of the fluid to rise without any help.

Height of the rise of the fluid due to capillary action depends on the adhesive force between the liquid and the glass surface.

It also depends on the cohesive force of the fluid, more the cohesive force in the fluid less will be the rise of the fluid.

Rise of the fluid also depends on the gravity.

Answer Link

Otras preguntas

Explain who or what "Año Viejo" is and its significance.
a antonym for biosphere
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
What is the sum of 6/10 plus 7/12
What kind of problems did increased urbanization cause? During time of industrial revolution