israelutegg israelutegg
  • 04-02-2020
  • Mathematics
contestada

3y + 6 divided by 2x

Respuesta :

angeliawilliams322 angeliawilliams322
  • 06-02-2020

Answer:

3 (x^2 +1)/x

Step-by-step explanation:

Answer Link

Otras preguntas

The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?
Why did North Carolina and South Carolina split into two colonies? A. They had different beliefs about slavery. B. They had large groups of competin
The drawing shows the measurements in a section of a circular design how long is the radius of the circle? F. 4.3 G. 7 H. 8.7 J. 10
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Homosociality reflects children's tendency to prefer social interactions with
what is the answer to #16???? Helpppppp
Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36
Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?
Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1
A transit train from Boston to New York and a passenger train from New York to Boston departed at the same time, at 3:00 PM. The distance between New York stati