casandra18gon casandra18gon
  • 01-02-2020
  • Biology
contestada

On topographic maps, how do you represent a steep slope?

Respuesta :

YassQueen47
YassQueen47 YassQueen47
  • 01-02-2020
Closely spaced contour lines represent a steep slope. The lines are closely spaced because the elevation of a steep slope changes greatly over a very short distance. Contour lines spaced far apart represent a gentle slope.
Answer Link

Otras preguntas

Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
who fought against each other in the crusades?
why is the square root of a perfect square always rational
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
why is the square root of a perfect square always rational
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.