tkindred63 tkindred63

02-10-2018
Social Studies

contestada

Which ruler was most responsible for uniting Greece? A. Alexander the Great B. Pericles C. King Philip D. Xerxes

Respuesta :

camdenmisiewic camdenmisiewic

02-10-2018

The answer is C, King Philip, or better know as Philip of Macedon.

Answer Link

britneeperales britneeperales

02-10-2018

I believe it would be A.) Alexander the great

Answer Link

Otras preguntas

Which statements describe instances of harassment rather than bullying? Check all that apply. Chen is often ridiculed because he is Asian. Kaylee is often teas

Gerri says that a spider use their fangs for the same purpose that crustaceans use their claws. Alana disagrees and says that spiders use their fangs for the s

the value x+x(x×) when x = 2

what's the ph of citric acid

Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month

if f(x)=4x-6, what is f(6)

Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.

What central idea does wollstonecraft explicitly state in this passage? a lack of education will not make women care only about household issues. women are natu

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which state ratified the constitution after congress agreed to amend the constitution to include the bill of rights